nucleotide count + robot simulator solutions elixir

elixir/nucleotide-count/.exercism/metadata.json

@@ -0,0 +1 @@
+{"track":"elixir","exercise":"nucleotide-count","id":"651779260530498397cb25e2a1209466","url":"https://exercism.io/my/solutions/651779260530498397cb25e2a1209466","handle":"Xevion","is_requester":true,"auto_approve":false}

elixir/nucleotide-count/.formatter.exs

@@ -0,0 +1,4 @@
+# Used by "mix format"
+[
+  inputs: ["{mix,.formatter}.exs", "{config,lib,test}/**/*.{ex,exs}"]
+]

elixir/nucleotide-count/.gitignore

@@ -0,0 +1,24 @@
+# The directory Mix will write compiled artifacts to.
+/_build/
+
+# If you run "mix test --cover", coverage assets end up here.
+/cover/
+
+# The directory Mix downloads your dependencies sources to.
+/deps/
+
+# Where third-party dependencies like ExDoc output generated docs.
+/doc/
+
+# Ignore .fetch files in case you like to edit your project deps locally.
+/.fetch
+
+# If the VM crashes, it generates a dump, let's ignore it too.
+erl_crash.dump
+
+# Also ignore archive artifacts (built via "mix archive.build").
+*.ez
+
+# Ignore package tarball (built via "mix hex.build").
+nucleotide_count-*.tar
+

elixir/nucleotide-count/README.md

@@ -0,0 +1,55 @@
+# Nucleotide Count
+
+Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
+
+The genetic language of every living thing on the planet is DNA.
+DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
+4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
+
+Here is an analogy:
+- twigs are to birds nests as
+- nucleotides are to DNA as
+- legos are to lego houses as
+- words are to sentences as...
+
+## Running tests
+
+Execute the tests with:
+
+```bash
+$ mix test
+```
+
+### Pending tests
+
+In the test suites, all but the first test have been skipped.
+
+Once you get a test passing, you can unskip the next one by
+commenting out the relevant `@tag :pending` with a `#` symbol.
+
+For example:
+
+```elixir
+# @tag :pending
+test "shouting" do
+  assert Bob.hey("WATCH OUT!") == "Whoa, chill out!"
+end
+```
+
+Or, you can enable all the tests by commenting out the
+`ExUnit.configure` line in the test suite.
+
+```elixir
+# ExUnit.configure exclude: :pending, trace: true
+```
+
+If you're stuck on something, it may help to look at some of
+the [available resources](https://exercism.io/tracks/elixir/resources)
+out there where answers might be found.
+
+## Source
+
+The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
+
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.

elixir/nucleotide-count/lib/nucleotide_count.ex

@@ -0,0 +1,32 @@
+defmodule NucleotideCount do
+  @doc """
+  Counts individual nucleotides in a DNA strand.
+
+  ## Examples
+
+  iex> NucleotideCount.count('AATAA', ?A)
+  4
+
+  iex> NucleotideCount.count('AATAA', ?T)
+  1
+  """
+  @spec count(charlist(), char()) :: non_neg_integer()
+  def count(strand, nucleotide) do
+    Enum.count(strand, &(&1 == nucleotide))
+  end
+
+  @doc """
+  Returns a summary of counts by nucleotide.
+
+  ## Examples
+
+  iex> NucleotideCount.histogram('AATAA')
+  %{?A => 4, ?T => 1, ?C => 0, ?G => 0}
+  """
+  @spec histogram(charlist()) :: map()
+  def histogram(strand) do
+    Enum.reduce(strand, %{?A => 0, ?T => 0, ?C => 0, ?G => 0}, fn nucleotide, counts ->
+      Map.update(counts, nucleotide, 1, &(&1 + 1))
+    end)
+  end
+end

elixir/nucleotide-count/mix.exs

@@ -0,0 +1,28 @@
+defmodule NucleotideCount.MixProject do
+  use Mix.Project
+
+  def project do
+    [
+      app: :nucleotide_count,
+      version: "0.1.0",
+      # elixir: "~> 1.8",
+      start_permanent: Mix.env() == :prod,
+      deps: deps()
+    ]
+  end
+
+  # Run "mix help compile.app" to learn about applications.
+  def application do
+    [
+      extra_applications: [:logger]
+    ]
+  end
+
+  # Run "mix help deps" to learn about dependencies.
+  defp deps do
+    [
+      # {:dep_from_hexpm, "~> 0.3.0"},
+      # {:dep_from_git, git: "https://github.com/elixir-lang/my_dep.git", tag: "0.1.0"}
+    ]
+  end
+end

elixir/nucleotide-count/test/nucleotide_count_test.exs

@@ -0,0 +1,37 @@
+defmodule NucleotideCountTest do
+  use ExUnit.Case
+
+  # @tag :pending
+  test "empty dna string has no adenine" do
+    assert NucleotideCount.count('', ?A) == 0
+  end
+
+  @tag :pending
+  test "repetitive cytosine gets counted" do
+    assert NucleotideCount.count('CCCCC', ?C) == 5
+  end
+
+  @tag :pending
+  test "counts only thymine" do
+    assert NucleotideCount.count('GGGGGTAACCCGG', ?T) == 1
+  end
+
+  @tag :pending
+  test "empty dna string has no nucleotides" do
+    expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 0}
+    assert NucleotideCount.histogram('') == expected
+  end
+
+  @tag :pending
+  test "repetitive sequence has only guanine" do
+    expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 8}
+    assert NucleotideCount.histogram('GGGGGGGG') == expected
+  end
+
+  @tag :pending
+  test "counts all nucleotides" do
+    s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
+    expected = %{?A => 20, ?T => 21, ?C => 12, ?G => 17}
+    assert NucleotideCount.histogram(s) == expected
+  end
+end

elixir/nucleotide-count/test/test_helper.exs

@@ -0,0 +1,2 @@
+ExUnit.start()
+# ExUnit.configure(exclude: :pending, trace: true)

elixir/robot-simulator/.exercism/metadata.json

@@ -0,0 +1 @@
+{"track":"elixir","exercise":"robot-simulator","id":"a8c52ea3878944528a085201a24226e4","url":"https://exercism.io/my/solutions/a8c52ea3878944528a085201a24226e4","handle":"Xevion","is_requester":true,"auto_approve":false}

elixir/robot-simulator/.formatter.exs

@@ -0,0 +1,4 @@
+# Used by "mix format"
+[
+  inputs: ["{mix,.formatter}.exs", "{config,lib,test}/**/*.{ex,exs}"]
+]

elixir/robot-simulator/.gitignore

@@ -0,0 +1,24 @@
+# The directory Mix will write compiled artifacts to.
+/_build/
+
+# If you run "mix test --cover", coverage assets end up here.
+/cover/
+
+# The directory Mix downloads your dependencies sources to.
+/deps/
+
+# Where third-party dependencies like ExDoc output generated docs.
+/doc/
+
+# Ignore .fetch files in case you like to edit your project deps locally.
+/.fetch
+
+# If the VM crashes, it generates a dump, let's ignore it too.
+erl_crash.dump
+
+# Also ignore archive artifacts (built via "mix archive.build").
+*.ez
+
+# Ignore package tarball (built via "mix hex.build").
+robot_simulator-*.tar
+

elixir/robot-simulator/README.md

@@ -0,0 +1,70 @@
+# Robot Simulator
+
+Write a robot simulator.
+
+A robot factory's test facility needs a program to verify robot movements.
+
+The robots have three possible movements:
+
+- turn right
+- turn left
+- advance
+
+Robots are placed on a hypothetical infinite grid, facing a particular
+direction (north, east, south, or west) at a set of {x,y} coordinates,
+e.g., {3,8}, with coordinates increasing to the north and east.
+
+The robot then receives a number of instructions, at which point the
+testing facility verifies the robot's new position, and in which
+direction it is pointing.
+
+- The letter-string "RAALAL" means:
+  - Turn right
+  - Advance twice
+  - Turn left
+  - Advance once
+  - Turn left yet again
+- Say a robot starts at {7, 3} facing north. Then running this stream
+  of instructions should leave it at {9, 4} facing west.
+
+## Running tests
+
+Execute the tests with:
+
+```bash
+$ mix test
+```
+
+### Pending tests
+
+In the test suites, all but the first test have been skipped.
+
+Once you get a test passing, you can unskip the next one by
+commenting out the relevant `@tag :pending` with a `#` symbol.
+
+For example:
+
+```elixir
+# @tag :pending
+test "shouting" do
+  assert Bob.hey("WATCH OUT!") == "Whoa, chill out!"
+end
+```
+
+Or, you can enable all the tests by commenting out the
+`ExUnit.configure` line in the test suite.
+
+```elixir
+# ExUnit.configure exclude: :pending, trace: true
+```
+
+If you're stuck on something, it may help to look at some of
+the [available resources](https://exercism.io/tracks/elixir/resources)
+out there where answers might be found.
+
+## Source
+
+Inspired by an interview question at a famous company.
+
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.

elixir/robot-simulator/lib/robot_simulator.ex

@@ -0,0 +1,93 @@
+defmodule RobotSimulator do
+  defmodule Robot, do: defstruct([:position, :direction])
+
+  @directions [:north, :east, :south, :west]
+  @turns %{"R" => 1, "L" => -1}
+
+  defguardp is_direction(direction) when direction in [:north, :east, :south, :west]
+
+  defguardp is_position(position)
+            when is_tuple(position) and tuple_size(position) == 2 and
+                   is_integer(elem(position, 0)) and is_integer(elem(position, 1))
+
+  @doc """
+  Create a Robot Simulator given an initial direction and position.
+
+  Valid directions are: `:north`, `:east`, `:south`, `:west`
+  """
+  @spec create(direction :: atom, position :: {integer, integer}) :: any
+  def create(direction \\ :north, position \\ {0, 0})
+
+  def create(direction, _position) when not is_direction(direction),
+    do: {:error, "invalid direction"}
+
+  def create(_direction, position) when not is_position(position),
+    do: {:error, "invalid position"}
+
+  def create(direction, position) do
+    %Robot{position: position, direction: direction}
+  end
+
+  @doc """
+  Simulate the robot's movement given a string of instructions.
+
+  Valid instructions are: "R" (turn right), "L", (turn left), and "A" (advance)
+  """
+  @spec simulate(robot :: any, instructions :: String.t()) :: any
+  def simulate(robot, ""), do: robot
+
+  def simulate(
+        %Robot{position: position, direction: direction} = robot,
+        <<head::bytes-size(1)>> <> tail
+      ) do
+    # {head, tail} = String.split_at(instructions, 1)
+
+    case head do
+      "A" ->
+        # Map.get_and_update!(robot, :position, &{&1, get_change(&1, robot.direction)})
+        simulate(%Robot{robot | position: get_change(position, direction)}, tail)
+
+      "L" ->
+        simulate(%Robot{robot | direction: get_turn(head, direction)}, tail)
+
+      "R" ->
+        simulate(%Robot{robot | direction: get_turn(head, direction)}, tail)
+
+      _ ->
+        {:error, "invalid instruction"}
+    end
+  end
+
+  @doc """
+  Return the robot's direction.
+
+  Valid directions are: `:north`, `:east`, `:south`, `:west`
+  """
+  @spec direction(robot :: any) :: atom
+  def direction(robot) do
+    robot.direction
+  end
+
+  @doc """
+  Return the robot's position.
+  """
+  @spec position(robot :: any) :: {integer, integer}
+  def position(robot) do
+    robot.position
+  end
+
+  def get_turn(turn, direction) do
+    @directions
+    |> Enum.fetch(rem(Enum.find_index(@directions, &(&1 == direction)) + @turns[turn], 4))
+    |> elem(1)
+  end
+
+  def get_change({x, y}, direction) do
+    case direction do
+      :north -> {x, y + 1}
+      :east -> {x + 1, y}
+      :south -> {x, y - 1}
+      :west -> {x - 1, y}
+    end
+  end
+end

elixir/robot-simulator/mix.exs

@@ -0,0 +1,28 @@
+defmodule RobotSimulator.MixProject do
+  use Mix.Project
+
+  def project do
+    [
+      app: :robot_simulator,
+      version: "0.1.0",
+      # elixir: "~> 1.8",
+      start_permanent: Mix.env() == :prod,
+      deps: deps()
+    ]
+  end
+
+  # Run "mix help compile.app" to learn about applications.
+  def application do
+    [
+      extra_applications: [:logger]
+    ]
+  end
+
+  # Run "mix help deps" to learn about dependencies.
+  defp deps do
+    [
+      # {:dep_from_hexpm, "~> 0.3.0"},
+      # {:dep_from_git, git: "https://github.com/elixir-lang/my_dep.git", tag: "0.1.0"}
+    ]
+  end
+end

elixir/robot-simulator/test/robot_simulator_test.exs

@@ -0,0 +1,74 @@
+defmodule RobotSimulatorTest do
+  use ExUnit.Case
+
+  test "create has sensible defaults" do
+    robot = RobotSimulator.create()
+    assert RobotSimulator.position(robot) == {0, 0}
+    assert RobotSimulator.direction(robot) == :north
+  end
+
+  @tag :pending
+  test "create works with valid arguments" do
+    robot = RobotSimulator.create(:north, {0, 0})
+    assert RobotSimulator.position(robot) == {0, 0}
+    assert RobotSimulator.direction(robot) == :north
+
+    robot = RobotSimulator.create(:south, {-10, 0})
+    assert RobotSimulator.position(robot) == {-10, 0}
+    assert RobotSimulator.direction(robot) == :south
+
+    robot = RobotSimulator.create(:east, {0, 10})
+    assert RobotSimulator.position(robot) == {0, 10}
+    assert RobotSimulator.direction(robot) == :east
+
+    robot = RobotSimulator.create(:west, {100, -100})
+    assert RobotSimulator.position(robot) == {100, -100}
+    assert RobotSimulator.direction(robot) == :west
+  end
+
+  @tag :pending
+  test "create errors if invalid direction given" do
+    position = {0, 0}
+    invalid_direction = {:error, "invalid direction"}
+
+    assert RobotSimulator.create(:invalid, position) == invalid_direction
+    assert RobotSimulator.create(0, position) == invalid_direction
+    assert RobotSimulator.create("east", position) == invalid_direction
+  end
+
+  @tag :pending
+  test "create errors if invalid position given" do
+    direction = :north
+    invalid_position = {:error, "invalid position"}
+
+    assert RobotSimulator.create(direction, {0, 0, 0}) == invalid_position
+    assert RobotSimulator.create(direction, {0, :invalid}) == invalid_position
+    assert RobotSimulator.create(direction, {"0", 0}) == invalid_position
+
+    assert RobotSimulator.create(direction, "invalid") == invalid_position
+    assert RobotSimulator.create(direction, 0) == invalid_position
+    assert RobotSimulator.create(direction, [0, 0]) == invalid_position
+    assert RobotSimulator.create(direction, nil) == invalid_position
+  end
+
+  @tag :pending
+  test "simulate robots" do
+    robot1 = RobotSimulator.create(:north, {0, 0}) |> RobotSimulator.simulate("LAAARALA")
+    assert RobotSimulator.direction(robot1) == :west
+    assert RobotSimulator.position(robot1) == {-4, 1}
+
+    robot2 = RobotSimulator.create(:east, {2, -7}) |> RobotSimulator.simulate("RRAAAAALA")
+    assert RobotSimulator.direction(robot2) == :south
+    assert RobotSimulator.position(robot2) == {-3, -8}
+
+    robot3 = RobotSimulator.create(:south, {8, 4}) |> RobotSimulator.simulate("LAAARRRALLLL")
+    assert RobotSimulator.direction(robot3) == :north
+    assert RobotSimulator.position(robot3) == {11, 5}
+  end
+
+  @tag :pending
+  test "simulate errors on invalid instructions" do
+    assert RobotSimulator.create() |> RobotSimulator.simulate("UUDDLRLRBASTART") ==
+             {:error, "invalid instruction"}
+  end
+end

elixir/robot-simulator/test/test_helper.exs

@@ -0,0 +1,2 @@
+ExUnit.start()
+# ExUnit.configure(exclude: :pending, trace: true)