mirror of
https://github.com/Xevion/exercism.git
synced 2026-01-31 00:24:08 -06:00
nucleotide count + robot simulator solutions elixir
This commit is contained in:
@@ -0,0 +1 @@
|
||||
{"track":"elixir","exercise":"nucleotide-count","id":"651779260530498397cb25e2a1209466","url":"https://exercism.io/my/solutions/651779260530498397cb25e2a1209466","handle":"Xevion","is_requester":true,"auto_approve":false}
|
||||
@@ -0,0 +1,4 @@
|
||||
# Used by "mix format"
|
||||
[
|
||||
inputs: ["{mix,.formatter}.exs", "{config,lib,test}/**/*.{ex,exs}"]
|
||||
]
|
||||
Vendored
+24
@@ -0,0 +1,24 @@
|
||||
# The directory Mix will write compiled artifacts to.
|
||||
/_build/
|
||||
|
||||
# If you run "mix test --cover", coverage assets end up here.
|
||||
/cover/
|
||||
|
||||
# The directory Mix downloads your dependencies sources to.
|
||||
/deps/
|
||||
|
||||
# Where third-party dependencies like ExDoc output generated docs.
|
||||
/doc/
|
||||
|
||||
# Ignore .fetch files in case you like to edit your project deps locally.
|
||||
/.fetch
|
||||
|
||||
# If the VM crashes, it generates a dump, let's ignore it too.
|
||||
erl_crash.dump
|
||||
|
||||
# Also ignore archive artifacts (built via "mix archive.build").
|
||||
*.ez
|
||||
|
||||
# Ignore package tarball (built via "mix hex.build").
|
||||
nucleotide_count-*.tar
|
||||
|
||||
@@ -0,0 +1,55 @@
|
||||
# Nucleotide Count
|
||||
|
||||
Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
|
||||
|
||||
The genetic language of every living thing on the planet is DNA.
|
||||
DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
|
||||
4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
|
||||
|
||||
Here is an analogy:
|
||||
- twigs are to birds nests as
|
||||
- nucleotides are to DNA as
|
||||
- legos are to lego houses as
|
||||
- words are to sentences as...
|
||||
|
||||
## Running tests
|
||||
|
||||
Execute the tests with:
|
||||
|
||||
```bash
|
||||
$ mix test
|
||||
```
|
||||
|
||||
### Pending tests
|
||||
|
||||
In the test suites, all but the first test have been skipped.
|
||||
|
||||
Once you get a test passing, you can unskip the next one by
|
||||
commenting out the relevant `@tag :pending` with a `#` symbol.
|
||||
|
||||
For example:
|
||||
|
||||
```elixir
|
||||
# @tag :pending
|
||||
test "shouting" do
|
||||
assert Bob.hey("WATCH OUT!") == "Whoa, chill out!"
|
||||
end
|
||||
```
|
||||
|
||||
Or, you can enable all the tests by commenting out the
|
||||
`ExUnit.configure` line in the test suite.
|
||||
|
||||
```elixir
|
||||
# ExUnit.configure exclude: :pending, trace: true
|
||||
```
|
||||
|
||||
If you're stuck on something, it may help to look at some of
|
||||
the [available resources](https://exercism.io/tracks/elixir/resources)
|
||||
out there where answers might be found.
|
||||
|
||||
## Source
|
||||
|
||||
The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
|
||||
|
||||
## Submitting Incomplete Solutions
|
||||
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
|
||||
@@ -0,0 +1,32 @@
|
||||
defmodule NucleotideCount do
|
||||
@doc """
|
||||
Counts individual nucleotides in a DNA strand.
|
||||
|
||||
## Examples
|
||||
|
||||
iex> NucleotideCount.count('AATAA', ?A)
|
||||
4
|
||||
|
||||
iex> NucleotideCount.count('AATAA', ?T)
|
||||
1
|
||||
"""
|
||||
@spec count(charlist(), char()) :: non_neg_integer()
|
||||
def count(strand, nucleotide) do
|
||||
Enum.count(strand, &(&1 == nucleotide))
|
||||
end
|
||||
|
||||
@doc """
|
||||
Returns a summary of counts by nucleotide.
|
||||
|
||||
## Examples
|
||||
|
||||
iex> NucleotideCount.histogram('AATAA')
|
||||
%{?A => 4, ?T => 1, ?C => 0, ?G => 0}
|
||||
"""
|
||||
@spec histogram(charlist()) :: map()
|
||||
def histogram(strand) do
|
||||
Enum.reduce(strand, %{?A => 0, ?T => 0, ?C => 0, ?G => 0}, fn nucleotide, counts ->
|
||||
Map.update(counts, nucleotide, 1, &(&1 + 1))
|
||||
end)
|
||||
end
|
||||
end
|
||||
@@ -0,0 +1,28 @@
|
||||
defmodule NucleotideCount.MixProject do
|
||||
use Mix.Project
|
||||
|
||||
def project do
|
||||
[
|
||||
app: :nucleotide_count,
|
||||
version: "0.1.0",
|
||||
# elixir: "~> 1.8",
|
||||
start_permanent: Mix.env() == :prod,
|
||||
deps: deps()
|
||||
]
|
||||
end
|
||||
|
||||
# Run "mix help compile.app" to learn about applications.
|
||||
def application do
|
||||
[
|
||||
extra_applications: [:logger]
|
||||
]
|
||||
end
|
||||
|
||||
# Run "mix help deps" to learn about dependencies.
|
||||
defp deps do
|
||||
[
|
||||
# {:dep_from_hexpm, "~> 0.3.0"},
|
||||
# {:dep_from_git, git: "https://github.com/elixir-lang/my_dep.git", tag: "0.1.0"}
|
||||
]
|
||||
end
|
||||
end
|
||||
@@ -0,0 +1,37 @@
|
||||
defmodule NucleotideCountTest do
|
||||
use ExUnit.Case
|
||||
|
||||
# @tag :pending
|
||||
test "empty dna string has no adenine" do
|
||||
assert NucleotideCount.count('', ?A) == 0
|
||||
end
|
||||
|
||||
@tag :pending
|
||||
test "repetitive cytosine gets counted" do
|
||||
assert NucleotideCount.count('CCCCC', ?C) == 5
|
||||
end
|
||||
|
||||
@tag :pending
|
||||
test "counts only thymine" do
|
||||
assert NucleotideCount.count('GGGGGTAACCCGG', ?T) == 1
|
||||
end
|
||||
|
||||
@tag :pending
|
||||
test "empty dna string has no nucleotides" do
|
||||
expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 0}
|
||||
assert NucleotideCount.histogram('') == expected
|
||||
end
|
||||
|
||||
@tag :pending
|
||||
test "repetitive sequence has only guanine" do
|
||||
expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 8}
|
||||
assert NucleotideCount.histogram('GGGGGGGG') == expected
|
||||
end
|
||||
|
||||
@tag :pending
|
||||
test "counts all nucleotides" do
|
||||
s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
|
||||
expected = %{?A => 20, ?T => 21, ?C => 12, ?G => 17}
|
||||
assert NucleotideCount.histogram(s) == expected
|
||||
end
|
||||
end
|
||||
@@ -0,0 +1,2 @@
|
||||
ExUnit.start()
|
||||
# ExUnit.configure(exclude: :pending, trace: true)
|
||||
@@ -0,0 +1 @@
|
||||
{"track":"elixir","exercise":"robot-simulator","id":"a8c52ea3878944528a085201a24226e4","url":"https://exercism.io/my/solutions/a8c52ea3878944528a085201a24226e4","handle":"Xevion","is_requester":true,"auto_approve":false}
|
||||
@@ -0,0 +1,4 @@
|
||||
# Used by "mix format"
|
||||
[
|
||||
inputs: ["{mix,.formatter}.exs", "{config,lib,test}/**/*.{ex,exs}"]
|
||||
]
|
||||
Vendored
+24
@@ -0,0 +1,24 @@
|
||||
# The directory Mix will write compiled artifacts to.
|
||||
/_build/
|
||||
|
||||
# If you run "mix test --cover", coverage assets end up here.
|
||||
/cover/
|
||||
|
||||
# The directory Mix downloads your dependencies sources to.
|
||||
/deps/
|
||||
|
||||
# Where third-party dependencies like ExDoc output generated docs.
|
||||
/doc/
|
||||
|
||||
# Ignore .fetch files in case you like to edit your project deps locally.
|
||||
/.fetch
|
||||
|
||||
# If the VM crashes, it generates a dump, let's ignore it too.
|
||||
erl_crash.dump
|
||||
|
||||
# Also ignore archive artifacts (built via "mix archive.build").
|
||||
*.ez
|
||||
|
||||
# Ignore package tarball (built via "mix hex.build").
|
||||
robot_simulator-*.tar
|
||||
|
||||
@@ -0,0 +1,70 @@
|
||||
# Robot Simulator
|
||||
|
||||
Write a robot simulator.
|
||||
|
||||
A robot factory's test facility needs a program to verify robot movements.
|
||||
|
||||
The robots have three possible movements:
|
||||
|
||||
- turn right
|
||||
- turn left
|
||||
- advance
|
||||
|
||||
Robots are placed on a hypothetical infinite grid, facing a particular
|
||||
direction (north, east, south, or west) at a set of {x,y} coordinates,
|
||||
e.g., {3,8}, with coordinates increasing to the north and east.
|
||||
|
||||
The robot then receives a number of instructions, at which point the
|
||||
testing facility verifies the robot's new position, and in which
|
||||
direction it is pointing.
|
||||
|
||||
- The letter-string "RAALAL" means:
|
||||
- Turn right
|
||||
- Advance twice
|
||||
- Turn left
|
||||
- Advance once
|
||||
- Turn left yet again
|
||||
- Say a robot starts at {7, 3} facing north. Then running this stream
|
||||
of instructions should leave it at {9, 4} facing west.
|
||||
|
||||
## Running tests
|
||||
|
||||
Execute the tests with:
|
||||
|
||||
```bash
|
||||
$ mix test
|
||||
```
|
||||
|
||||
### Pending tests
|
||||
|
||||
In the test suites, all but the first test have been skipped.
|
||||
|
||||
Once you get a test passing, you can unskip the next one by
|
||||
commenting out the relevant `@tag :pending` with a `#` symbol.
|
||||
|
||||
For example:
|
||||
|
||||
```elixir
|
||||
# @tag :pending
|
||||
test "shouting" do
|
||||
assert Bob.hey("WATCH OUT!") == "Whoa, chill out!"
|
||||
end
|
||||
```
|
||||
|
||||
Or, you can enable all the tests by commenting out the
|
||||
`ExUnit.configure` line in the test suite.
|
||||
|
||||
```elixir
|
||||
# ExUnit.configure exclude: :pending, trace: true
|
||||
```
|
||||
|
||||
If you're stuck on something, it may help to look at some of
|
||||
the [available resources](https://exercism.io/tracks/elixir/resources)
|
||||
out there where answers might be found.
|
||||
|
||||
## Source
|
||||
|
||||
Inspired by an interview question at a famous company.
|
||||
|
||||
## Submitting Incomplete Solutions
|
||||
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
|
||||
@@ -0,0 +1,93 @@
|
||||
defmodule RobotSimulator do
|
||||
defmodule Robot, do: defstruct([:position, :direction])
|
||||
|
||||
@directions [:north, :east, :south, :west]
|
||||
@turns %{"R" => 1, "L" => -1}
|
||||
|
||||
defguardp is_direction(direction) when direction in [:north, :east, :south, :west]
|
||||
|
||||
defguardp is_position(position)
|
||||
when is_tuple(position) and tuple_size(position) == 2 and
|
||||
is_integer(elem(position, 0)) and is_integer(elem(position, 1))
|
||||
|
||||
@doc """
|
||||
Create a Robot Simulator given an initial direction and position.
|
||||
|
||||
Valid directions are: `:north`, `:east`, `:south`, `:west`
|
||||
"""
|
||||
@spec create(direction :: atom, position :: {integer, integer}) :: any
|
||||
def create(direction \\ :north, position \\ {0, 0})
|
||||
|
||||
def create(direction, _position) when not is_direction(direction),
|
||||
do: {:error, "invalid direction"}
|
||||
|
||||
def create(_direction, position) when not is_position(position),
|
||||
do: {:error, "invalid position"}
|
||||
|
||||
def create(direction, position) do
|
||||
%Robot{position: position, direction: direction}
|
||||
end
|
||||
|
||||
@doc """
|
||||
Simulate the robot's movement given a string of instructions.
|
||||
|
||||
Valid instructions are: "R" (turn right), "L", (turn left), and "A" (advance)
|
||||
"""
|
||||
@spec simulate(robot :: any, instructions :: String.t()) :: any
|
||||
def simulate(robot, ""), do: robot
|
||||
|
||||
def simulate(
|
||||
%Robot{position: position, direction: direction} = robot,
|
||||
<<head::bytes-size(1)>> <> tail
|
||||
) do
|
||||
# {head, tail} = String.split_at(instructions, 1)
|
||||
|
||||
case head do
|
||||
"A" ->
|
||||
# Map.get_and_update!(robot, :position, &{&1, get_change(&1, robot.direction)})
|
||||
simulate(%Robot{robot | position: get_change(position, direction)}, tail)
|
||||
|
||||
"L" ->
|
||||
simulate(%Robot{robot | direction: get_turn(head, direction)}, tail)
|
||||
|
||||
"R" ->
|
||||
simulate(%Robot{robot | direction: get_turn(head, direction)}, tail)
|
||||
|
||||
_ ->
|
||||
{:error, "invalid instruction"}
|
||||
end
|
||||
end
|
||||
|
||||
@doc """
|
||||
Return the robot's direction.
|
||||
|
||||
Valid directions are: `:north`, `:east`, `:south`, `:west`
|
||||
"""
|
||||
@spec direction(robot :: any) :: atom
|
||||
def direction(robot) do
|
||||
robot.direction
|
||||
end
|
||||
|
||||
@doc """
|
||||
Return the robot's position.
|
||||
"""
|
||||
@spec position(robot :: any) :: {integer, integer}
|
||||
def position(robot) do
|
||||
robot.position
|
||||
end
|
||||
|
||||
def get_turn(turn, direction) do
|
||||
@directions
|
||||
|> Enum.fetch(rem(Enum.find_index(@directions, &(&1 == direction)) + @turns[turn], 4))
|
||||
|> elem(1)
|
||||
end
|
||||
|
||||
def get_change({x, y}, direction) do
|
||||
case direction do
|
||||
:north -> {x, y + 1}
|
||||
:east -> {x + 1, y}
|
||||
:south -> {x, y - 1}
|
||||
:west -> {x - 1, y}
|
||||
end
|
||||
end
|
||||
end
|
||||
@@ -0,0 +1,28 @@
|
||||
defmodule RobotSimulator.MixProject do
|
||||
use Mix.Project
|
||||
|
||||
def project do
|
||||
[
|
||||
app: :robot_simulator,
|
||||
version: "0.1.0",
|
||||
# elixir: "~> 1.8",
|
||||
start_permanent: Mix.env() == :prod,
|
||||
deps: deps()
|
||||
]
|
||||
end
|
||||
|
||||
# Run "mix help compile.app" to learn about applications.
|
||||
def application do
|
||||
[
|
||||
extra_applications: [:logger]
|
||||
]
|
||||
end
|
||||
|
||||
# Run "mix help deps" to learn about dependencies.
|
||||
defp deps do
|
||||
[
|
||||
# {:dep_from_hexpm, "~> 0.3.0"},
|
||||
# {:dep_from_git, git: "https://github.com/elixir-lang/my_dep.git", tag: "0.1.0"}
|
||||
]
|
||||
end
|
||||
end
|
||||
@@ -0,0 +1,74 @@
|
||||
defmodule RobotSimulatorTest do
|
||||
use ExUnit.Case
|
||||
|
||||
test "create has sensible defaults" do
|
||||
robot = RobotSimulator.create()
|
||||
assert RobotSimulator.position(robot) == {0, 0}
|
||||
assert RobotSimulator.direction(robot) == :north
|
||||
end
|
||||
|
||||
@tag :pending
|
||||
test "create works with valid arguments" do
|
||||
robot = RobotSimulator.create(:north, {0, 0})
|
||||
assert RobotSimulator.position(robot) == {0, 0}
|
||||
assert RobotSimulator.direction(robot) == :north
|
||||
|
||||
robot = RobotSimulator.create(:south, {-10, 0})
|
||||
assert RobotSimulator.position(robot) == {-10, 0}
|
||||
assert RobotSimulator.direction(robot) == :south
|
||||
|
||||
robot = RobotSimulator.create(:east, {0, 10})
|
||||
assert RobotSimulator.position(robot) == {0, 10}
|
||||
assert RobotSimulator.direction(robot) == :east
|
||||
|
||||
robot = RobotSimulator.create(:west, {100, -100})
|
||||
assert RobotSimulator.position(robot) == {100, -100}
|
||||
assert RobotSimulator.direction(robot) == :west
|
||||
end
|
||||
|
||||
@tag :pending
|
||||
test "create errors if invalid direction given" do
|
||||
position = {0, 0}
|
||||
invalid_direction = {:error, "invalid direction"}
|
||||
|
||||
assert RobotSimulator.create(:invalid, position) == invalid_direction
|
||||
assert RobotSimulator.create(0, position) == invalid_direction
|
||||
assert RobotSimulator.create("east", position) == invalid_direction
|
||||
end
|
||||
|
||||
@tag :pending
|
||||
test "create errors if invalid position given" do
|
||||
direction = :north
|
||||
invalid_position = {:error, "invalid position"}
|
||||
|
||||
assert RobotSimulator.create(direction, {0, 0, 0}) == invalid_position
|
||||
assert RobotSimulator.create(direction, {0, :invalid}) == invalid_position
|
||||
assert RobotSimulator.create(direction, {"0", 0}) == invalid_position
|
||||
|
||||
assert RobotSimulator.create(direction, "invalid") == invalid_position
|
||||
assert RobotSimulator.create(direction, 0) == invalid_position
|
||||
assert RobotSimulator.create(direction, [0, 0]) == invalid_position
|
||||
assert RobotSimulator.create(direction, nil) == invalid_position
|
||||
end
|
||||
|
||||
@tag :pending
|
||||
test "simulate robots" do
|
||||
robot1 = RobotSimulator.create(:north, {0, 0}) |> RobotSimulator.simulate("LAAARALA")
|
||||
assert RobotSimulator.direction(robot1) == :west
|
||||
assert RobotSimulator.position(robot1) == {-4, 1}
|
||||
|
||||
robot2 = RobotSimulator.create(:east, {2, -7}) |> RobotSimulator.simulate("RRAAAAALA")
|
||||
assert RobotSimulator.direction(robot2) == :south
|
||||
assert RobotSimulator.position(robot2) == {-3, -8}
|
||||
|
||||
robot3 = RobotSimulator.create(:south, {8, 4}) |> RobotSimulator.simulate("LAAARRRALLLL")
|
||||
assert RobotSimulator.direction(robot3) == :north
|
||||
assert RobotSimulator.position(robot3) == {11, 5}
|
||||
end
|
||||
|
||||
@tag :pending
|
||||
test "simulate errors on invalid instructions" do
|
||||
assert RobotSimulator.create() |> RobotSimulator.simulate("UUDDLRLRBASTART") ==
|
||||
{:error, "invalid instruction"}
|
||||
end
|
||||
end
|
||||
@@ -0,0 +1,2 @@
|
||||
ExUnit.start()
|
||||
# ExUnit.configure(exclude: :pending, trace: true)
|
||||
Reference in New Issue
Block a user