nucleotide count + robot simulator solutions elixir

elixir/nucleotide-count/.exercism/metadata.json

@@ -0,0 +1 @@
+{"track":"elixir","exercise":"nucleotide-count","id":"651779260530498397cb25e2a1209466","url":"https://exercism.io/my/solutions/651779260530498397cb25e2a1209466","handle":"Xevion","is_requester":true,"auto_approve":false}

elixir/nucleotide-count/.formatter.exs

@@ -0,0 +1,4 @@
+# Used by "mix format"
+[
+  inputs: ["{mix,.formatter}.exs", "{config,lib,test}/**/*.{ex,exs}"]
+]

elixir/nucleotide-count/.gitignore

@@ -0,0 +1,24 @@
+# The directory Mix will write compiled artifacts to.
+/_build/
+
+# If you run "mix test --cover", coverage assets end up here.
+/cover/
+
+# The directory Mix downloads your dependencies sources to.
+/deps/
+
+# Where third-party dependencies like ExDoc output generated docs.
+/doc/
+
+# Ignore .fetch files in case you like to edit your project deps locally.
+/.fetch
+
+# If the VM crashes, it generates a dump, let's ignore it too.
+erl_crash.dump
+
+# Also ignore archive artifacts (built via "mix archive.build").
+*.ez
+
+# Ignore package tarball (built via "mix hex.build").
+nucleotide_count-*.tar
+

elixir/nucleotide-count/README.md

@@ -0,0 +1,55 @@
+# Nucleotide Count
+
+Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
+
+The genetic language of every living thing on the planet is DNA.
+DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
+4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
+
+Here is an analogy:
+- twigs are to birds nests as
+- nucleotides are to DNA as
+- legos are to lego houses as
+- words are to sentences as...
+
+## Running tests
+
+Execute the tests with:
+
+```bash
+$ mix test
+```
+
+### Pending tests
+
+In the test suites, all but the first test have been skipped.
+
+Once you get a test passing, you can unskip the next one by
+commenting out the relevant `@tag :pending` with a `#` symbol.
+
+For example:
+
+```elixir
+# @tag :pending
+test "shouting" do
+  assert Bob.hey("WATCH OUT!") == "Whoa, chill out!"
+end
+```
+
+Or, you can enable all the tests by commenting out the
+`ExUnit.configure` line in the test suite.
+
+```elixir
+# ExUnit.configure exclude: :pending, trace: true
+```
+
+If you're stuck on something, it may help to look at some of
+the [available resources](https://exercism.io/tracks/elixir/resources)
+out there where answers might be found.
+
+## Source
+
+The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
+
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.

elixir/nucleotide-count/lib/nucleotide_count.ex

@@ -0,0 +1,32 @@
+defmodule NucleotideCount do
+  @doc """
+  Counts individual nucleotides in a DNA strand.
+
+  ## Examples
+
+  iex> NucleotideCount.count('AATAA', ?A)
+  4
+
+  iex> NucleotideCount.count('AATAA', ?T)
+  1
+  """
+  @spec count(charlist(), char()) :: non_neg_integer()
+  def count(strand, nucleotide) do
+    Enum.count(strand, &(&1 == nucleotide))
+  end
+
+  @doc """
+  Returns a summary of counts by nucleotide.
+
+  ## Examples
+
+  iex> NucleotideCount.histogram('AATAA')
+  %{?A => 4, ?T => 1, ?C => 0, ?G => 0}
+  """
+  @spec histogram(charlist()) :: map()
+  def histogram(strand) do
+    Enum.reduce(strand, %{?A => 0, ?T => 0, ?C => 0, ?G => 0}, fn nucleotide, counts ->
+      Map.update(counts, nucleotide, 1, &(&1 + 1))
+    end)
+  end
+end

elixir/nucleotide-count/mix.exs

@@ -0,0 +1,28 @@
+defmodule NucleotideCount.MixProject do
+  use Mix.Project
+
+  def project do
+    [
+      app: :nucleotide_count,
+      version: "0.1.0",
+      # elixir: "~> 1.8",
+      start_permanent: Mix.env() == :prod,
+      deps: deps()
+    ]
+  end
+
+  # Run "mix help compile.app" to learn about applications.
+  def application do
+    [
+      extra_applications: [:logger]
+    ]
+  end
+
+  # Run "mix help deps" to learn about dependencies.
+  defp deps do
+    [
+      # {:dep_from_hexpm, "~> 0.3.0"},
+      # {:dep_from_git, git: "https://github.com/elixir-lang/my_dep.git", tag: "0.1.0"}
+    ]
+  end
+end

elixir/nucleotide-count/test/nucleotide_count_test.exs

@@ -0,0 +1,37 @@
+defmodule NucleotideCountTest do
+  use ExUnit.Case
+
+  # @tag :pending
+  test "empty dna string has no adenine" do
+    assert NucleotideCount.count('', ?A) == 0
+  end
+
+  @tag :pending
+  test "repetitive cytosine gets counted" do
+    assert NucleotideCount.count('CCCCC', ?C) == 5
+  end
+
+  @tag :pending
+  test "counts only thymine" do
+    assert NucleotideCount.count('GGGGGTAACCCGG', ?T) == 1
+  end
+
+  @tag :pending
+  test "empty dna string has no nucleotides" do
+    expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 0}
+    assert NucleotideCount.histogram('') == expected
+  end
+
+  @tag :pending
+  test "repetitive sequence has only guanine" do
+    expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 8}
+    assert NucleotideCount.histogram('GGGGGGGG') == expected
+  end
+
+  @tag :pending
+  test "counts all nucleotides" do
+    s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
+    expected = %{?A => 20, ?T => 21, ?C => 12, ?G => 17}
+    assert NucleotideCount.histogram(s) == expected
+  end
+end

elixir/nucleotide-count/test/test_helper.exs

@@ -0,0 +1,2 @@
+ExUnit.start()
+# ExUnit.configure(exclude: :pending, trace: true)