PowerShell - nucleotide-count

powershell/nucleotide-count/.exercism/config.json

@@ -0,0 +1,22 @@
+{
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "authors": [
+    "gyssels"
+  ],
+  "contributors": [
+    "kchenery"
+  ],
+  "files": {
+    "solution": [
+      "NucleotideCount.ps1"
+    ],
+    "test": [
+      "NucleotideCount.tests.ps1"
+    ],
+    "example": [
+      ".meta/NucleotideCount.example.ps1"
+    ]
+  },
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "http://rosalind.info/problems/dna/"
+}

powershell/nucleotide-count/.exercism/metadata.json

@@ -0,0 +1 @@
+{"track":"powershell","exercise":"nucleotide-count","id":"7817a1dab53e4af18785a020a493fa16","url":"https://exercism.org/tracks/powershell/exercises/nucleotide-count","handle":"Xevion","is_requester":true,"auto_approve":false}

powershell/nucleotide-count/.version

@@ -0,0 +1 @@
+0

powershell/nucleotide-count/HELP.md

@@ -0,0 +1,33 @@
+# Help
+
+## Running the tests
+
+To run the tests run the command `Invoke-Pester` from within the exercise directory.
+
+## Submitting your solution
+
+You can submit your solution using the `exercism submit NucleotideCount.ps1` command.
+This command will upload your solution to the Exercism website and print the solution page's URL.
+
+It's possible to submit an incomplete solution which allows you to:
+
+- See how others have completed the exercise
+- Request help from a mentor
+
+## Need to get help?
+
+If you'd like help solving the exercise, check the following pages:
+
+- The [PowerShell track's documentation](https://exercism.org/docs/tracks/powershell)
+- [Exercism's support channel on gitter](https://gitter.im/exercism/support)
+- The [Frequently Asked Questions](https://exercism.org/docs/using/faqs)
+
+Should those resources not suffice, you could submit your (incomplete) solution to request mentoring.
+
+To get help if you are having trouble, you can use one of the following resources:
+
+- [Powershell Documentation][powershell docs]
+
+[Add more resources]: TODO
+
+[powershell docs]: https://docs.microsoft.com/en-us/powershell/

powershell/nucleotide-count/NucleotideCount.ps1

@@ -0,0 +1,36 @@
+Function Get-NucleotideCount() {
+    <#
+    .SYNOPSIS
+    Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
+    
+    .DESCRIPTION
+    The genetic language of every living thing on the planet is DNA.
+    DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
+    4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
+
+    The function counts the occurances of A, C, G and T in the supplied strand. It then outputs in the format:
+
+    A:0, C:0, G:0, T:0
+    
+    .PARAMETER Strand
+    The DNA strand to count
+    
+    .EXAMPLE
+    Get-NucleotideCount -Strand "ACGTAGCTT"
+    
+    Retuns: A:2 C:2 G:2 T:3
+    #>
+    [CmdletBinding()]
+    Param(
+        [string]$Strand
+    )
+
+    if ($Strand -notmatch "^[ACGT]*$") {
+        Throw "Invalid DNA Strand"
+    }
+
+    $counts = @{"A" = 0; "C" = 0; "G" = 0; "T" = 0}
+    foreach ($char in $Strand.ToCharArray()) { $counts[$char.ToString()] += 1 }
+
+    return "A:$($counts['A']) C:$($counts['C']) G:$($counts['G']) T:$($counts['T'])"
+}

powershell/nucleotide-count/NucleotideCount.tests.ps1

@@ -0,0 +1,25 @@
+BeforeAll {
+    . ".\NucleotideCount.ps1"
+}
+
+Describe "NucleotideCountTests" {
+	It "empty strand" {
+        Get-NucleotideCount -Strand "" | Should -BeExactly "A:0 C:0 G:0 T:0"
+	}
+
+	It "can count one nucleotide in single-character input" {
+		Get-NucleotideCount -Strand "G" | Should -BeExactly "A:0 C:0 G:1 T:0"
+	}
+
+	It "strand with repeated nucleotide" {
+		Get-NucleotideCount -Strand "GGGGGGG" | Should -BeExactly "A:0 C:0 G:7 T:0"
+	}
+
+	It "strand with multiple nucleotides" {
+		Get-NucleotideCount -Strand "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" | Should -BeExactly "A:20 C:12 G:17 T:21"
+	}
+
+	It "strand with invalid nucleotides" {
+		{ Get-NucleotideCount -Strand "AGXXACT" } | Should -Throw
+	}	
+}

powershell/nucleotide-count/README.md

@@ -0,0 +1,40 @@
+# Nucleotide Count
+
+Welcome to Nucleotide Count on Exercism's PowerShell Track.
+If you need help running the tests or submitting your code, check out `HELP.md`.
+
+## Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed. All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine. A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```
+
+## Source
+
+### Created by
+
+- @gyssels
+
+### Contributed to by
+
+- @kchenery
+
+### Based on
+
+The Calculating DNA Nucleotides_problem at Rosalind - http://rosalind.info/problems/dna/